generic image
Processing...
  • Games
  • Catalog
  • Develop
  • Robux
  • Search in Players
  • Search in Games
  • Search in Catalog
  • Search in Groups
  • Search in Library
  • Log In
  • Sign Up
  • Games
  • Catalog
  • Develop
  • Robux
   
ROBLOX Forum » Club Houses » ROBLOX Talk
Home Search
 

Re: Give me some math or biology problems.. OR SOMETHING!!

Previous Thread :: Next Thread 
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
20 Dec 2013 11:47 PM
Winter break is torture! I don't have any homework at all. No academic activity. I just had my last day of PE, FCS, and art. I'm not sure that makes me very happy, but..
Just give me something that a 7th grader in honors pre algebra and science classes can do. Keep in mind that I should be in a higher biology class, but there is no higher one. Ask away.

catfish in a skillet
Report Abuse
SoEpic1337 is not online. SoEpic1337
Joined: 22 Oct 2011
Total Posts: 28506
20 Dec 2013 11:49 PM
5 x 2 / 3 + x = 5. What is X?

i said cha cha - real smooth, this could be dangerous
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
20 Dec 2013 11:51 PM
In the first side to the right of the 5, is that a variable?
Give me a multi-step equation. Make me go, "ugm there r variable on both side LOL!!"

catfish in a skillet
Report Abuse
bickyyy is not online. bickyyy
Joined: 16 Nov 2007
Total Posts: 28514
20 Dec 2013 11:52 PM
2 - 3






should i
^SIG^
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
20 Dec 2013 11:53 PM
" 2-3 "
2-3 = -1

catfish in a skillet
Report Abuse
SeaborgiumSg is not online. SeaborgiumSg
Joined: 20 Jul 2013
Total Posts: 1608
20 Dec 2013 11:59 PM
Given that cosx=4/5 and tanx < 0 find secx and cotx.
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 12:01 AM
I was really hoping for a biology problem...
Cells? Organelles like rough endoplasmic reticulum and golgi bodies?
Come ON guys! You know I'm too tired to pretend to know what you're talking about in math!

catfish in a skillet
Report Abuse
BladeMasterMarc is not online. BladeMasterMarc
Joined: 28 Aug 2013
Total Posts: 2828
21 Dec 2013 12:02 AM
1+1
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 12:03 AM
*Untracks thread*

catfish in a skillet
Report Abuse
BladeMasterMarc is not online. BladeMasterMarc
Joined: 28 Aug 2013
Total Posts: 2828
21 Dec 2013 12:05 AM
are you asian
Report Abuse
SeaborgiumSg is not online. SeaborgiumSg
Joined: 20 Jul 2013
Total Posts: 1608
21 Dec 2013 12:09 AM
Let me think of a biology question.

Name the suture between the occipital bone and parietal bones.
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 12:13 AM
I don't have an excuse for not knowing that one.

catfish in a skillet
Report Abuse
TheFastCheetah2013 is not online. TheFastCheetah2013
Joined: 19 Aug 2013
Total Posts: 2281
21 Dec 2013 12:14 AM
1x1=
you cant figure it out
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 12:15 AM
1 x 1 = 1.

If x is a variable, I won't even try.

catfish in a skillet
Report Abuse
Yamsman123 is not online. Yamsman123
Joined: 03 Feb 2009
Total Posts: 21916
21 Dec 2013 12:18 AM
you have a segment of DNA with the nucleotides arranged like so
GCAGCTAGTTGAGCGTACACCGTCAATAGCTAC

what are the amino acids you end up with after going through transcription and translation

make like a jcs and bot it
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 09:45 AM
Even with the specific structure of a short line of DNA, it's impossible to tell from my research. 1.5 on the pH scale, I guess..?

catfish in a skillet
Report Abuse
Homucifer is not online. Homucifer
Joined: 19 Nov 2013
Total Posts: 24
21 Dec 2013 09:47 AM
dude do you not know 6th grade math
Report Abuse
WoopiWoopi is not online. WoopiWoopi
Joined: 21 Nov 2010
Total Posts: 7206
21 Dec 2013 09:54 AM
When I was in 6th grade, no one was doing any sort of equations with negative integers even. No one.
My school isn't in the U.S. Common Core, so that could be why.

catfish in a skillet
Report Abuse
Previous Thread :: Next Thread 
Page 1 of 1
 
 
ROBLOX Forum » Club Houses » ROBLOX Talk
   
 
   
  • About Us
  • Jobs
  • Blog
  • Parents
  • Help
  • Terms
  • Privacy

©2017 Roblox Corporation. Roblox, the Roblox logo, Robux, Bloxy, and Powering Imagination are among our registered and unregistered trademarks in the U.S. and other countries.



Progress
Starting Roblox...
Connecting to Players...
R R

Roblox is now loading. Get ready to play!

R R

You're moments away from getting into the game!

Click here for help

Check Remember my choice and click Launch Application in the dialog box above to join games faster in the future!

Gameplay sponsored by:
Loading 0% - Starting game...
Get more with Builders Club! Join Builders Club
Choose Your Avatar
I have an account
generic image