|
| 20 Dec 2013 11:47 PM |
Winter break is torture! I don't have any homework at all. No academic activity. I just had my last day of PE, FCS, and art. I'm not sure that makes me very happy, but.. Just give me something that a 7th grader in honors pre algebra and science classes can do. Keep in mind that I should be in a higher biology class, but there is no higher one. Ask away.
catfish in a skillet |
|
|
| Report Abuse |
|
|
|
| 20 Dec 2013 11:49 PM |
5 x 2 / 3 + x = 5. What is X?
i said cha cha - real smooth, this could be dangerous |
|
|
| Report Abuse |
|
|
|
| 20 Dec 2013 11:51 PM |
In the first side to the right of the 5, is that a variable? Give me a multi-step equation. Make me go, "ugm there r variable on both side LOL!!"
catfish in a skillet |
|
|
| Report Abuse |
|
|
bickyyy
|
  |
| Joined: 16 Nov 2007 |
| Total Posts: 28514 |
|
| |
|
|
| 20 Dec 2013 11:53 PM |
" 2-3 " 2-3 = -1
catfish in a skillet |
|
|
| Report Abuse |
|
|
|
| 20 Dec 2013 11:59 PM |
Given that cosx=4/5 and tanx < 0 find secx and cotx.
|
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 12:01 AM |
I was really hoping for a biology problem... Cells? Organelles like rough endoplasmic reticulum and golgi bodies? Come ON guys! You know I'm too tired to pretend to know what you're talking about in math!
catfish in a skillet |
|
|
| Report Abuse |
|
|
| |
|
|
| 21 Dec 2013 12:03 AM |
*Untracks thread*
catfish in a skillet |
|
|
| Report Abuse |
|
|
| |
|
|
| 21 Dec 2013 12:09 AM |
Let me think of a biology question.
Name the suture between the occipital bone and parietal bones. |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 12:13 AM |
I don't have an excuse for not knowing that one.
catfish in a skillet |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 12:14 AM |
1x1= you cant figure it out |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 12:15 AM |
1 x 1 = 1.
If x is a variable, I won't even try.
catfish in a skillet |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 12:18 AM |
you have a segment of DNA with the nucleotides arranged like so GCAGCTAGTTGAGCGTACACCGTCAATAGCTAC
what are the amino acids you end up with after going through transcription and translation
make like a jcs and bot it |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 09:45 AM |
Even with the specific structure of a short line of DNA, it's impossible to tell from my research. 1.5 on the pH scale, I guess..?
catfish in a skillet |
|
|
| Report Abuse |
|
|
Homucifer
|
  |
| Joined: 19 Nov 2013 |
| Total Posts: 24 |
|
|
| 21 Dec 2013 09:47 AM |
| dude do you not know 6th grade math |
|
|
| Report Abuse |
|
|
|
| 21 Dec 2013 09:54 AM |
When I was in 6th grade, no one was doing any sort of equations with negative integers even. No one. My school isn't in the U.S. Common Core, so that could be why.
catfish in a skillet |
|
|
| Report Abuse |
|
|